PharmD Info

Genetic codings are essentially the instructions that determine the traits and characteristics of an organism. These instructions are encoded in the DNA of the organism, which is made up of four nucleotide bases: adenine (A), thymine (T), cytosine (C), and guanine (G). These nucleotide bases are arranged in a specific sequence to create genetic code.

The genetic code is read by cells to create the proteins that carry out many of the functions of the body. The genetic code is read in groups of three nucleotide bases, called codons. Each codon codes for a specific amino acid, which are the building blocks of proteins.

Here's an example of how the genetic code is read:

• The DNA sequence is first transcribed into a messenger RNA (mRNA) molecule. The mRNA sequence is complementary to the DNA sequence, with thymine (T) being replaced by uracil (U).

• The mRNA molecule is then read by the ribosome, which is a cellular machine that translates the mRNA sequence into a protein.

• The ribosome reads the mRNA sequence in groups of three nucleotides (codons). Each codon codes for a specific amino acid.

• The ribosome reads the codons one by one and adds the corresponding amino acid to the growing protein chain.

• Once the ribosome reaches a stop codon, the protein is complete, and it is released from the ribosome.

.
The genetic code is universal, meaning that the same codons code for the same amino acids in all organisms. This is why genetic engineering and genetic modification are possible across different species. However, there are some exceptions and variations in the genetic code that are found in some organisms.

Here's an example of how the genetic code is read using a specific DNA sequence:

DNA Sequence: ATGCGTCCAGTGACCATGAAGAG

Transcription: The DNA sequence is transcribed into mRNA by RNA polymerase. The mRNA sequence is complementary to the DNA sequence, with thymine (T) being replaced by uracil (U).

mRNA Sequence: AUGCGUCCAGUGACCAUGAAGAG

Translation: The mRNA sequence is read by the ribosome in groups of three nucleotides (codons). Each codon codes for a specific amino acid, as shown in the genetic code chart below:

Genetic Code Chart:



The ribosome reads the codons one by one and adds the corresponding amino acid to the growing protein chain. So, the first codon AUG codes for methionine, the second codon CGU codes for serine, and so on.

Protein Sequence: Met-Ser-Pro-Val-Met-Lys-Arg

Stop Codon: Once the ribosome reaches a stop codon, the protein is complete, and it is released from the ribosome. There are three stop codons: UAA, UAG, and UGA. In this example, there is no stop codon in the given DNA sequence, so the protein would continue to be elongated until it reaches a stop codon in the mRNA sequence.

This is a simple example of how the genetic code is read. In reality, there are many more factors that can influence gene expression and protein synthesis, such as regulatory elements, splicing, post-translational modifications, and more.